Πανελλήνιες 2023: Οι απαντήσεις στα θέματα της Βιολογίας
Πανελλήνιες 2023: Οι προτεινόμενες απαντήσεις στο ΜΑΘΗΜΑ: Βιολογία προσανατολισμού

Πανελλήνιες 2023: Οι προτεινόμενες απαντήσεις στο ΜΑΘΗΜΑ: Βιολογία προσανατολισμού

ΘΕΜΑ Α

Α1. γ
Α2. β
Α3. β
Α4. γ
Α5. δ

ΘΕΜΑ Β

Β1.

α) α → νερό
β→ υπεροξείδιο του υδρογόνου
γ → καταλάση

β) Στις πρωτεΐνες

γ) Αμινοξέα

δ) 20 διαφορετικά αμινοξέα που διαφέρουν στις πλευρικές ομάδες R.

B2. Αποικία: Μία αποικία είναι ένα σύνολο από µικροοργανισµούς, που έχουν προέλθει από διαδοχικές
διαιρέσεις ενός κυττάρου, όταν αυτό αναπτύσσεται σε στερεό θρεπτικό υλικό. Οι αποικίες είναι ορατές µε
γυµνό οφθαλµό.
Στατική φάση: κατά τη φάση αυτή ο πληθυσµός των βακτηρίων δεν αυξάνεται, λόγω εξάντλησης κάποιου
θρεπτικού συστατικού ή λόγω συσσώρευσης τοξικών προϊόντων από το μεταβολισμό των
μικροοργανισµών.
Επιχιασμός: Ορισμένες φορές, εξαιτίας της σύναψης, είναι δυνατό οι μη αδελφές χρωματίδες των ομόλογων
χρωμοσωμάτων, που έχουν γίνει πια ορατές, να «μπερδευτούν» μεταξύ τους. Έτσι δημιουργούνται τα
χαρακτηριστικά και ορατά από το οπτικό μικροσκόπιο χιάσματα, στα οποία οι χρωματίδες κόβονται και
επανασυγκολλώνται, αφού όμως έχουν ανταλλάξει μεταξύ τους ομόλογα χρωμοσωμικά τμήματα. Το
φαινόμενο αυτό, που ονομάζεται επιχιασμός, δίνει τη δυνατότητα στα ομόλογα χρωμοσώματα να
ανταλλάξουν μεταξύ τους γονίδια.

Β3. Τα μειονεκτήματα αυτά είναι:

• ∆εν µπορούν όλοι οι µολυσµατικοί παράγοντες να αναπτυχθούν σε κυτταροκαλλιέργεια και έτσι δεν
έχουν αναπτυχθεί εµβόλια για πολλές ασθένειες.
• Ορισμένοι ιοί των ζώων αναπτύσσονται με αργό ρυθμό σε κυτταροκαλλιέργειες και συνεπώς η απόδοσή
τους είναι πολύ χαµηλή, άρα και τα εµβόλια γίνονται πολύ ακριβά.
• Χρειάζονται μεγάλες προφυλάξεις, για να μην εκτεθεί το προσωπικό που κατασκευάζει τα εμβόλια στον
παθογόνο παράγοντα.
• ∆εν είναι όλα τα εµβόλια αποτελεσµατικά για µια ασθένεια π.χ. για τον ιό του AIDS γίνονται συνεχείς
ανεπιτυχείς προσπάθειες κατασκευής εµβολίου.

Β4. Πρωτεϊνοσύνθεση πραγματοποιείται:

 Στα ελεύθερα ριβοσώματα του κυτταροπλάσματος
 Στα ριβοσώματα του αδρού ενδοπλασματικού δικτύου
 Στα μιτοχόνδρια και
 Στους χλωροπλάστες

Β5. Είναι φανερό ότι η χρησιµοποίηση διαγονιδιακών φυτών και ζώων για την αύξηση της φυτικής και
ζωικής παραγωγής παρουσιάζει σημαντικά πλεονεκτήματα έναντι της κλασικής μεθόδου των
διασταυρώσεων. Αυτά επιγραµµατικά είναι τα παρακάτω:
• Επιλογή και προσθήκη µόνο επιθυµητών ιδιοτήτων µε ταυτόχρονη διατήρηση των παλαιών επιθυµητών
χαρακτηριστικών.
• Ταχύτατη παραγωγή βελτιωμένων φυτών και ζώων σε σχέση µε παραδοσιακές τεχνικές.


ΘΕΜΑ Γ

Γ1.

α) Μη διαχωρισμός των ομολόγων χρωμοσωμάτων του 11 ου ζεύγους κατά την 1 η Μειωτική διαίρεση.
β) 2n = 38
γ) Κύτταρο Α: 40 μόρια DNA
Κύτταρο Β: 36 μόρια DNA
δ) Οι δύο γαμέτες που προκύπτουν από το κύτταρο Α θα φέρουν 20 χρωμοσώματα και οι δύο γαμέτες που
προκύπτουν από το κύτταρο Β θα φέρουν 18 χρωμοσώματα.

Γ2. Αν θέλουμε να κλωνοποιήσουμε μόνο τα γονίδια που εκφράζονται σε συγκεκριμένα κύτταρα, τότε κατασκευάζουμε τις cDNA βιβλιοθήκες. Οι cDNA βιβλιοθήκες περιέχουν αντίγραφα των mRNA όλων των γονιδίων που εκφράζονται στα κύτταρα αυτά και έχουν το πλεονέκτημα απομόνωσης μόνο των αλληλουχιών των γονιδίων που μεταφράζονται σε αμινοξέα, δηλαδή των εξωνίων. Για να κατασκευαστεί μία cDNA βιβλιοθήκη, απομονώνεται το ολικό «ώριμο» mRNA από κύτταρα που εκφράζουν το συγκεκριμένο γονίδιο. Επομένως κάποιοι κλώνοι είναι ίδιοι γιατί τα γονίδια εκφράζονται και στους δύο τύπους κυττάρων και κάποιοι διαφορετικοί καθώς πρόκειται για τα ειδικά γονίδια του κάθε κυτταρικού τύπου.

Γ3. Η γονιδιωματική βιβλιοθήκη προκύπτει με την επεξεργασία του συνόλου του γενετικού υλικού που υπάρχει στο κύτταρο επομένως εάν διαφέρουν τα φυλετικά χρωμοσώματα θα διαφέρουν και κάποιοι κλώνοι. Οι κλώνοι δεν θα είναι ακριβώς ίδιοι καθώς οι δύο γαμέτες μπορεί να φέρουν το Χ ή Υ χρωμόσωμα ενώ ταυτόχρονα λόγω του τυχαίου διαχωρισμού των χρωμοσωμάτων τα γαμετικά κύτταρα θα έχουν και διαφορετικά αλληλόμορφα στις ομόλογες περιοχές γεγονός που μπορεί να οδηγήσει σε διαφορετικό μοτίβο πέψης από τις περιοριστικές ενδονουκλεάσες και διαφορετικούς κλώνους.

Γ4. Όπως φαίνεται από τις δοσμένες αναλογίες το χαρακτηριστικό των κόκκινων ματιών εμφανίζεται μόνο σε θηλυκά άτομα και των λευκών μόνο σε αρσενικά άτομα γεγονός που υποδεικνύει ότι πρόκειται για φυλοσύνδετο χαρακτηριστικό. Μαζί με το γεγονός της αντιστροφής του φαινοτύπου (μητέρα με λευκά μάτια και πατέρας με κόκκινα ) ισχύει ότι Χ Κ = κόκκινο > Χ κ =λευκό και οι γονότυποι των γονέων για το χαρακτηριστικό είναι Χ Κ Υ και Χ κΧ κ . Για το χαρακτηριστικό των μεγάλων και μικρών κεραιών οι αναλογία είναι ανεξαρτήτως φύλου 2:1 μεταξύ μεγάλων και μικρών αντίστοιχα, γεγονός που υποδεικνύει την ύπαρξη θνησιγόνου.

Ταυτόχρονα με το γεγονός του ότι ο ένας γονέας έχει τις μικρές κεραίες και ο άλλος τις μεγάλες ισχύει ότι πρόκειται για πολλαπλά αλληλόμορφα. Μ1= μεγάλο Μ2 = μικρό Μ3= θνησιγόνο Και οι γονότυποι των γονέων είναι: Μ1Μ3 του αρσενικού και Μ2Μ3 του θηλυκού

Συνολικά: P: Μ1Μ3 Χ Κ Υ * Μ2Μ3Χ κΧ κ Γαμέτες Μ1Χ Κ, Μ1 Υ, Μ3Χ Κ , Μ3 Υ Μ2 Χ κ Μ3 Χ κ

ΘΕΜΑ Δ

Δ1.

Α) Πρόδρομο 5’UUC AUG GAA UUC CAU G(AAAGGG)UA GGG GAA UUC UAG CCC3’ Ώριμο 5’UUC AUG GAA UUC CAU GUA GGG GAA UUC UAG CCC3’

Β) Αριθμός αμινοξέων: 8

Δ2.

α) 5’ AATTCCATG(AAAGGG)TAGGGG 3’ 3’ GGTAC(TTTCCC)ATCCCCTTAA 5’

β) Μετά την ενσωμάτωση δημιουργείται η εξής αλληλουχία: 5’GAATTCCATGAAAGGGTAGGGGAATTC3’ 3’CTTAAGGTACTTTCCCATCCCCTTAAG5’ Μετά την ενσωμάτωση στο πλασμίδιο και τον μετασχηματισμό των βακτηρίων από το mRNA δεν αφαιρείται το εσώνιο και μεταφράζεται κανονικά, γιατί οι προκαρυωτικοί οργανισμοί δεν διαθέτουν μηχανισμούς ωρίμανσης του πρόδρομου mRNA. Τα κωδικόνια του γονιδίου που μεταφράζονται είναι: 5’ ΑΤG AAA GGG 3’

Δ3.

Α) 3’ TACAGAGAGATATACGGTAGTCAGATAAGTA 5’ 5’ ATGTCTCTCTATATGCCATCAGTCTATTCAT 3’

B) 5’ AUGAAUAGACUGAUGGCAUAUAGAGAGACAU 3’

Δ4.

Γνωρίζουμε ότι κατά την έναρξη της μετάφρασης το mRNA προσδένεται, μέσω μιας αλληλουχίας που υπάρχει στην 5' αμετάφραση περιοχή του, με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος, σύμφωνα με τους κανόνες της συμπληρωματικότητας των βάσεων. Το πρώτο κωδικόνιο του mRNA είναι πάντοτε AUG και σ' αυτό προσδένεται το tRNA που φέρει το αμινοξύ μεθειονίνη. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του mRNA στη μικρή υπομονάδα του ριβοσώματος και του tRNA που μεταφέρει τη μεθειονίνη ονομάζεται σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης. Έτσι το mRNA το οποίο θα παράγεται από το γονίδιο της εικόνας 4 θα πρέπει να διαθέτει εκτός από κωδικόνιο έναρξης και λήξης και κατάλληλη αλληλουχία στην οποία θα προσδένεται η μικρή ριβοσωμική υπομονάδα μέσω του rRNA της. Κωδικόνιο έναρξης και λήξης παρατηρείται και στην 1η και στην 2η αλυσίδα, επομένως διακρίνουμε τις εξής περιπτώσεις.

Περίπτωση 1: Αν η αλυσίδα ΙΙΙ είναι η κωδική του γονιδίου για το mRNA τότε το παραγόμενο mRNA είναι συμπληρωματικό και αντιπαράλληλο με την μη κωδική αλυσίδα IV και έχει αλληλουχία: 5’ – CCAGAGAGACGUAUGCUACAACAGAUAUAAGAUCCC 3’

Περίπτωση 2: Αν η αλυσίδα IV είναι η κωδική του γονιδίου για το mRNA τότε το mRNA είναι συμπληρωματικό και αντιπαράλληλο με την μη κωδική αλυσίδα III και έχει αλληλουχία:

5’ – GGUCUCUCUGCAUACGAUGUUGUCUAUAUUCUAGGG -3’

Η αλληλουχία του rRNA είναι: 3’ - UACAGAGAGAUAUACGGUAGUCAGAUAAGUA - 5’

Παρατηρούμε ότι η αλληλουχία 8 νουκλεοτιδίων 3’ – CAGAGAGA – 5’ του rRNA είναι συμπληρωματική και αντιπαράλληλη της αλληλουχίας 5’ -GUCUCUCU-3’ της 5’ αμετάφραστης περιοχής του mRNA, άρα αποδεκτή είναι μόνο η 2η περίπτωση και η κωδική αλυσίδα του γονιδίου είναι η IV.

Διαβάστε εδώ: Πανελλήνιες Εξετάσεις 2023 -  Όλα τα θέματα κι οι απαντήσεις τους

Όλες οι σημαντικές και έκτακτες ειδήσεις σήμερα

Παραιτήθηκε διευθυντής σχολείου που απειλήθηκε με καθαίρεση και πειθαρχικές ποινές επειδή αντιτάχθηκε σε αυτή στην αξιολόγηση

Παν.Πατρών: Μοριοδοτούμενο σεμινάριο ΕΙΔΙΚΗ ΑΓΩΓΗΣ με μόνο 65Є εγγραφή - έως 17 Απριλίου

Μοριοδοτούμενο σεμινάριο Ειδικής Αγωγής (ΕΛΜΕΠΑ) με μόνο 50Є εγγραφή- αιτήσεις ως 17/4

2ος Πανελλήνιος Γραπτός Διαγωνισμός ΑΣΕΠ: Τα 2 μαθήματα εξέτασης και η ύλη

Proficiency και Lower μόνο 95 ευρώ σε 2 μόνο ημέρες στα χέρια σας (ΧΩΡΙΣ προφορικά, ΧΩΡΙΣ έκθεση!)

ΕΥΚΟΛΕΣ ΠΙΣΤΟΠΟΙΗΣΕΙΣ ΙΣΠΑΝΙΚΩΝ και ΙΤΑΛΙΚΩΝ για εκπαιδευτικούς - Πάρτε τις άμεσα

Google news logo Ακολουθήστε το Alfavita στo Google News Viber logo Ακολουθήστε το Alfavita στo Viber

σχετικά άρθρα

hoynta.jpg
Μνήμες από την εκπαίδευση επί Χούντας: Το πειθαρχικό δίκαιο για τους εκπαιδευτικούς και το ποινολόγιο για τους μαθητές
57 χρόνια πριν τα σχολεία, οι εκπαιδευτικοί και οι μαθητές
Μνήμες από την εκπαίδευση επί Χούντας: Το πειθαρχικό δίκαιο για τους εκπαιδευτικούς και το ποινολόγιο για τους μαθητές
dictionary-lexiko-xenes_glosses-foreign_lagnuage.jpg
Πως λέμε στα ελληνικά: σέλφι, σπικάζ, ρίαλ εστέιτ ή μπίζνες πλαν;
Επειδή σε λίγο, για να επικοινωνήσουμε μεταξύ μας ή για να δούμε τηλεόραση, θα χρειαζόμαστε πτυχίο αγγλικής φιλολογίας, μήπως είναι πιο εύκολο να τα...
Πως λέμε στα ελληνικά: σέλφι, σπικάζ, ρίαλ εστέιτ ή μπίζνες πλαν;