Πανελλαδικές 2020: Προτεινόμενες απαντήσεις στο μάθημα της Βιολογίας (παλαιό σύστημα)
Προτεινόμενες απαντήσεις για το μάθημα της Βιολογίας Προσανατολισμού Γ' Λυκείου (παλαιό σύστημα) από το Φροντιστήριο Ορόσημο

Αναλυτικά οι απαντήσεις:

ΘΕΜΑ Α

Α1. β

Α2. α

Α3. β

Α4. α

Α5. δ

ΘΕΜΑ Β

Β1.

α. 4

β. 5

γ. 1

δ. 3

Β2.

  1. Ένα αντίσωμα αναγνωρίζει μόνο μία περιοχή του αντιγόνου, η οποία ονομάζεται αντιγονικός καθοριστής.
  2. Διαγονιδιακοί οργανισμοί είναι οι φυτικοί και ζωικοί οργανισμοί που έχουν δημιουργηθεί με τεχνικές Γενετικής Μηχανικής και περιέχουν γονίδια από άλλο οργανισμό, συνήθως διαφορετικού είδους.
  3. Ο φορέας κλωνοποίησης είναι ένα μόριο DNA, π.χ. πλασμίδιο ή DNA φάγων, το οποίο μπορεί να αυτοδιπλασιάζεται ανεξάρτητα μέσα σε ένα κύτταρο-ξενιστή όπως ένα βακτήριο.

Β3.

  • Ο καρκίνος δεν προκαλείται από μία μετάλλαξη, αλλά από τη «συσσώρευση» αρκετών γενετικών αλλαγών στα κύτταρα. Οι μεταλλάξεις αυτές είναι αποτέλεσμα διαφορετικών περιβαλλοντικών μεταλλαξογόνων παραγόντων όπως η ακτινοβολία ή χημικές ουσίες.
  • Στη δημιουργία κάθε είδους καρκίνου συμμετέχουν συνήθως τόσο τα ογκογονίδια όσο και τα ογκοκατασταλτικά γονίδια.

 

Β4.

  • Για τη δημιουργία γονιδιωματικής βιβλιοθήκης:
    • Περιοριστική ενδονουκλεάση (για το DNA του οργανισμού - δότη και για το φορέα κλωνοποίησης)
    • DNA δεσμάση
  • Για τη δημιουργία cDNA βιβλιοθήκης:
    • Αντίστροφη μεταγραφάση
    • DNA πολυμεράση
    • Περιοριστική ενδονουκλεάση (μόνο για το φορέα κλωνοποίησης)
    • DNA δεσμάση

Β5.

  • 5’ και 3’ αμετάφραστες περιοχές
  • Γονίδια που μεταγράφονται σε tRNA
  • Γονίδια που μεταγράφονται σε rRNA
  • Κωδικόνια λήξης

ΘΕΜΑ Γ

Γ1.

Σελίδα 79 σχολικού βιβλίου:

Το γονίδιο Ι… είναι ii.

Η φαινυλκετονουρία κληρονομείται με αυτοσωμικό υπολοιπόμενο τύπο κληρονομικότητας.

Έστω Φ: φυσιολογική κατάσταση

φ: φαινυλκετονουρία

1ος Τρόπος: Αμοιβαία μετατόπιση ανάμεσα σε τμήμα του χρωμοσώματος 9 που φέρει το αλληλόμορφο ΙΒ και τμήμα του χρωμοσώματος 12 που φέρει το αλληλόμορφο φ:

viologia palaio 1

 

2ος Τρόπος: Αμοιβαία μετατόπιση ανάμεσα σε τμήμα του χρωμοσώματος 9 που φέρει το αλληλόμορφο ΙΒ και τμήμα του χρωμοσώματος 12 που δε φέρει το αλληλόμορφο φ:

viologia palaio 2

Γ2.

Οι γαμέτες που προκύπτουν από τον πρώτο τρόπο είναι οι:

viologia palaio 3

 

Διαστάυρωση του γαμέτη 1 και 2 με φυσιολογικό γαμέτη της γυναίκας ι φ προκύπτει το πρώτο και το δεύτερο παιδί αντίστοιχα:

P: IAΦ x i φ

F1: ΙΑiΦφ 1ο παιδί

P: IAIB x i φ

F1: IAIBiφ 2ο παιδί

Οι γαμέτες που προκύπτουν από τον δεύτερο τρόπο είναι οι:

viologia palaio 4

Διαστάυρωση του γαμέτη 1 και 2 με φυσιολογικό γαμέτη της γυναίκας ι φ προκύπτει το πρώτο και το δεύτερο παιδί αντίστοιχα:

P: IAΦ x i φ

F1: ΙΑiΦφ 1ο παιδί

P: IAIBφ x i φ

F1: IAIBi φφ 2ο παιδί

Γ3.

Επειδή κάθε κύηση είναι ανεξάρτητο γεγονός και δεν σχετίζεται με το αποτέλεσμα των προηγούμενων κυήσεων η πιθανότητα το τρίτο παιδί να έχει φυσιολογικό φαινότυπο και καρυότυπο είναι 1/4. Η πιθανότητα το παιδί να είναι και κορίτσι είναι συνολικά 1/8.

Γ4.

Για τη δρεπανοκυτταρική αναιμία, στο έμβρυο μπορεί να γίνει διάγνωση με ανάλυση της αλληλουχίας των βάσεων του DNA και εντοπισμός του μεταλλαγμένου γονιδίου βS. Για τη φαινυλκετονουρία, στο έμβρυο μπορεί να γίνει διάγνωση με ανάλυση της αλληλουχίας των βάσεων του DNA και βιοχημική ανάλυση. Για τους γονείς, μπορεί να γίνει δοκιμασία δρεπάνωσης, βιοχημική ανάλυση για τον προσδιορισμό της αιμοσφαιρίνης HbS και ανάλυση αλληλουχίας βάσεων DNA.

ΘΕΜΑ Δ

Δ1. Το γονίδιο Α κωδικοποιεί το mRNA.

Το mRNA που προκύπτει από τη μεταγραφή του γονιδίου και τα άκρα του είναι:

5’- GAAUUCGGAACAUGCCCGGGUCAGCCUGAGAGAAUUCCC -3’

Δ2. To γονίδιο Γ κωδικοποιεί το tRNA. Το tRNA που μεταφέρει το αμινοξύ μεθειονίνη έχει αντικωδικόνιο που είναι μια τριπλέτα νουκλεοτιδίων,  συμπληρωματική και αντιπαράλληλη με το κωδικόνιο  5’-AUG-3’. Επομένως το αντικωδικόνιο του tRNA είναι 3’- UAC-5’. To tRNA που συντίθεται κατά τη διαδικασία της μεταγραφής του γονιδίου που κωδικοποιεί το tRNA είναι συμπληρωματικό και αντιπαράλληλο με τη μεταγραφόμενη αλυσίδα που ονομάζεται μη κωδική. Επομένως εντοπίζουμε στη μη κωδική αλυσίδα του γονιδίου την τριπλέτα                  5’- ATG-3’. Επομένως μεταγραφόμενη αλυσίδα είναι η 1.

Δ3. Το γονίδιο Β είναι το γονίδιο που κωδικοποιεί το rRNA. Κατά την έναρξη της μετάφρασης το mRNA προσδένεται, συμπληρωματικά και αντιπαράλληλα , μέσω μιας αλληλουχίας που υπάρχει στην 5’ αμετάφραστη περιοχή του με το rRNA της μικρής υπομονάδας του ριβοσώματος. Η 5’ αμετάφραστη περιοχή του mRNA με την οποία συνδέεται το rRNA της μικρής υπομονάδας του ριβοσώματος είναι: 5’- GGAAC-3’. Άρα το rRNA της μικρής υπομονάδας του ριβοσώματος είναι 3’- CCUUG-5’. To rRNA που συντίθεται κατά τη διαδικασία της μεταγραφής του γονιδίου που κωδικοποιεί το rRNA είναι συμπληρωματικό και αντιπαράλληλο με τη μεταγραφόμενη αλυσίδα που ονομάζεται μη κωδική.

Επομένως εντοπίζουμε στη μη κωδική αλυσίδα του γονιδίου την αλληλουχία 5’- GGAAC-3’. Άρα μεταγραφόμενη είναι η αλυσίδα 2.

Δ4.

  1. Θα χρησιμοποιήσουμε την EcoRI και την περιοριστική ενδονουκλεάση ΠΕ-Ι
  2. 5’ – CAATTC –3’

3’– GTTAAG –5’

Και                5’ – GAATTG –3’

3’–  CTTAAC –5’

  1. Η ΠΕ-Ι δεν κόβει το ανασυνδυασμένο πλασμίδιο διότι δεν υπάρχει η αλληλουχία αναγνώρισής της σε αυτό.

ΟΡΟΣΗΜΟ ΠΕΙΡΑΙΑ

Διαβάστε Επίσης:


ΑΣΕΠ: Tο ΚΟΡΥΦΑΙΟ Σεμινάριο στην ΕΙΔΙΚΗ ΑΓΩΓΗ με ανοικτές αιτήσεις

Νέες Προσλήψεις Φιλολόγων (όλες οι ειδικότητες) σε όλη την Ελλάδα

Μοριοδότηση - Επιμόρφωση Εκπαιδευτικών Π.Ε. και Δ.Ε. στη Σχολική Ψυχολογία

ΠΙΣΤΟΠΟΙΗΣΗ Η/Υ ΣΕ 10 ΗΜΕΡΕΣ ΕΞ ΑΠΟΣΤΑΣΕΩΣ ΜΕ ΑΠΕΡΙΟΡΙΣΤΕΣ ΔΩΡΕΑΝ ΕΠΑΝΕΞΕΤΑΣΕΙΣ

 

 

σχετικά άρθρα

Εκλογές αιρετών: Η πλατφόρμα ZEUS καλεί τα μέλη εφορευτικών επιτροπών σε επιμόρφωση
Εκλογές αιρετών: Η πλατφόρμα ZEUS καλεί τα μέλη εφορευτικών επιτροπών σε επιμόρφωση
Μήνυμα του Γραφείου Αρωγής Χρηστών «Ζευς» προς τα διορισμένα μέλη των εφορευτικών επιτροπών για τις εκλογές αιρετών 
Εκλογές αιρετών: Η πλατφόρμα ZEUS καλεί τα μέλη εφορευτικών επιτροπών σε επιμόρφωση
Εσείς κα Κεραμέως κάνατε τεστ και μάθατε! Για εμάς δεν προβλέπεται
Εσείς κα Κεραμέως κάνατε τεστ και μάθατε! Για εμάς δεν προβλέπεται
Με αφορμή τη κα Νίκη Κεραμέως και τον Κορονοϊο, λίγα λόγια για τα τεστ Covid-19 στους μαθητές και στα σχολεία - Τι αναφέρει πρωτόκολλο του ΕΟΔΥ
Εσείς κα Κεραμέως κάνατε τεστ και μάθατε! Για εμάς δεν προβλέπεται
Εκλογές αιρετών: «Εκλογές βίας και νοθείας - Να παραιτηθεί η υπουργός»
Εκλογές αιρετών: «Εκλογές βίας και νοθείας - Να παραιτηθεί η υπουργός»
Κριτική της «Εκπαιδευτικής Λέσχης» για τους χειρισμούς της Νίκης Κεραμεώς στις εκλογές αιρετών εκπροσώπων στα υπηρεσιακά συμβούλια του υπουργείου...
Εκλογές αιρετών: «Εκλογές βίας και νοθείας - Να παραιτηθεί η υπουργός»
Κρούσματα σε σχολεία: Θετικοί στον κορονοϊό εργαζόμενοι στη ΔΠΕ Λάρισας και στην ΠΔΕ Θεσσαλίας
Κρούσματα σε σχολεία: Θετικοί στον κορονοϊό εργαζόμενοι στη ΔΠΕ Λάρισας και στην ΠΔΕ Θεσσαλίας
Αυξάνονται ραγδαία τα κρούσματα στη χώρα - Θετικοί στον κορονοϊό εργαζόμενοι στη Διεύθυνση Πρωτοβάθμιας Εκπαίδευσης Λάρισας και στην Περιφερειακή...
Κρούσματα σε σχολεία: Θετικοί στον κορονοϊό εργαζόμενοι στη ΔΠΕ Λάρισας και στην ΠΔΕ Θεσσαλίας