ΠΑΝΕΛΛΗΝΙΕΣ 2014: Προτεινόμενα θέματα και απαντήσεις για το μάθημα της Βιολογίας Κατεύθυνσης
Προσφορά του φροντιστηριακού ομίλου ΕΝΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1ο

Να επιλέξετε τη σωστή απάντηση:

  1. Σιωπηλή μετάλλαξη λόγω αντικατάστασης βάσης δε μπορεί να επιτευχθεί στο κωδικόνιο που κωδικοποιεί:

α. τη βαλίνη               γ. τη μεθειονίνη

β. το γλουταμινικό οξύ      δ. τη φαινυλαλανίνη

 

  1. Σε ποια εκ των παρακάτω μεταλλάξεων δε παρατηρούμε αυξομείωση της ποσότητας του γενετικού υλικού;

α. τρισωμία                   γ. έλλειψη

β. διπλασιασμός                   δ. αναστροφή

  1. Το μιτοχονδριακό DNA στους περισσότερους οργανισμούς είναι κυκλικό μόριο. Εξαίρεση, δηλαδή γραμμικό μόριο, μπορούμε να συναντήσουμε σε κάποια/κάποιους:

α. βακτήρια                                 γ. πρωτόζωα

β. ιούς                                     δ. μύκητες

 

  1. Ένα mRNA που προκύπτει από τη μεταγραφή ενός οπερονίου διαφέρει από αυτό ενός ευκαρυωτικού κυττάρου:

α. Στο ότι έχει περισσότερα από ένα κωδικόνιο λήξης και έναρξης

β. Στο ότι έχει πληροφορίες περισσοτέρων του ενός γονιδίων

γ. Στο ότι έχει περισσότερες από μία 5’ αμετάφραστη περιοχή

δ. Τα α και β

  1. Μια γονιδιωματική βιβλιοθήκη από βακτηριοφάγους λ αποτελείται:

α.       Από κλώνους βακτηρίων που έχουν μολυνθεί από το βακτηριοφάγο λ

β.       Από πλασμίδια που περιέχουν ανασυνδυασμένα μόρια DNA

γ.    Από το σύνολο των φάγων που περιέχουν στο γονιδίωμά τους τα κομμάτια του συνολικού DNA του κυττάρου δότη

δ.       Από ιούς ζωικών κυττάρων που περιέχουν το συνολικό DNA του κυττάρου δότη

ΘΕΜΑ 2Ο

  1. Να περιγράψετε το σύμπλοκο έναρξης της μετάφρασης.
  2. Να καταγράψετε μερικές εφαρμογές των μονοκλωνικών αντισωμάτων.
  3. Σε ποια δεδομένα βασίστηκαν οι Watson και Crick για να διατυπώσουν το μοντέλο της διπλής έλικας;
  4. Πότε και πώς ενεργοποιείται το οπερόνιο της λακτόζης των βακτηρίων σε θρεπτικό υλικό που περιέχει γλυκόζη και λακτόζη;
  5. Κατά την εξέταση γενετικού υλικού από διάφορα ανθρώπινα κύτταρα παρατηρήθηκαν τα παρακάτω:

1ο κύτταρο:     44 χρωμοσώματα που το καθένα τους ήταν ίδιο σε μορφή με κάποιο άλλο, άλλα και 2 ακόμη που διέφεραν αρκετά σε μήκος μεταξύ τους. Όλα βρέθηκαν στο μέγιστο βαθμό συσπείρωσης.

2ο κύτταρο:     44 χρωμοσώματα που το καθένα τους ήταν ίδιο σε μορφή με κάποιο άλλο, αλλά και 2 ακόμη που ήταν ίδια σε μήκος μεταξύ τους. Όλα βρέθηκαν σε μέγιστο βαθμό συσπείρωσης.

3ο κύτταρο:     46 ινίδια χρωματίνης σχηματίζοντας ζεύγη αδερφών χρωματίδων σε μέτρια συσπείρωση και το καθένα ίδιο με κάποιο άλλο.

4ο κύτταρο:     44 χρωμοσώματα που το καθένα τους ήταν ίδιο σε μορφή με κάποιο άλλο, και ένα επιπλέον χωρίς όμοιό του. Όλα βρέθηκαν σε μέγιστο βαθμό συσπείρωσης.

5ο κύτταρο:       23 ινίδια χρωματίνης ανόμοια μεταξύ τους.

 

  1. Τι είδους κύτταρα είναι και σε ποιά φάση του κυτταρικού κύκλου βρίσκονται;
  2. Τι είδους μικροσκόπιο μπορεί να χρειάστηκε για τις σχετικές παρατηρήσεις;

ΘΕΜΑ 3Ο

Γ1. Ο διαβήτης είναι μία ασθένεια που χαρακτηρίζεται από έλλειψη ή μείωση ινσουλίνης στον οργανισμό του ασθενούς.

α. Για ποιο λόγο είναι σημαντική η ινσουλίνη στον ανθρώπινο οργανισμό;

β. Να περιγράψετε τη δομή της ινσουλίνης.

γ. Περιγράψτε τη μέθοδο για την παραγωγή της με τη χρήση βακτηρίων.

 

Γ2. Στο παρακάτω γενεαλογικό δέντρο περιγράφεται η κληρονόμηση της αχονδροπλασίας σε μία οικογένεια.

α. Σύμφωνα με το γενεαλογικό δέντρο και τη βοήθεια των κατάλληλων διασταυρώσεων να καταδείξετε τον τύπο κληρονόμησης της αχονδροπλασίας.

β.  Η αχονδροπλασία αποτελεί μία μορφή νανισμού και οφείλεται σε μεταλλάξεις που πραγματοποιούνται στο γονίδιο FGFR3 του 3ου χρωμοσώματος, με αποτέλεσμα τη μη σωστή ανάπτυξη και συντήρηση των οστών. Ακόμα και σήμερα όμως δεν υπάρχει θεραπεία για την ασθένεια αυτή. Μερικοί γιατροί βέβαια χρησιμοποιούν την αυξητική ορμόνη με σκοπό την αύξηση του ρυθμού ανάπτυξης των οστών ενός παιδιού (με αμφίβολα ακόμη μακροπρόθεσμα αποτελέσματα) . Η αυξητική ορμόνη, όπως γνωρίζουμε,  ανήκει στην κατηγορία των «φαρμακευτικών πρωτεϊνών» και μπορεί να συλλεχθεί από το γάλα διαγονιδιακών ζώων. Να περιγράψτε τη μέθοδο παραγωγής και να αναφέρετε έναν τρόπο που θα μπορούσε να διαγνωσθεί, με ασφάλεια, η συγκεκριμένη ασθένεια κατά την εμβρυική φάση.

ΘΕΜΑ 4Ο

Δίνεται η ακολουθία βάσεων μιας πολυνουκλεοτιδικής αλυσίδας ενός μορίου DNA ευκαρυωτικού κυττάρου:

5’ – TTGAATTCAAATGTGTCGAATTACAGAGTGATTAGAATTCGG – 3’

  1. Να γράψετε την ακολουθία βάσεων του mRNA που θα προκύψει από τη μεταγραφή της παραπάνω αλυσίδας.
  2. Πόσα αμινοξέα κωδικοποιούνται από το παραπάνω γονίδιο;
  3. Ποιά tRNA θα συμμετέχουν στη μετάφρασή του;
  4. Κατά τη διαίρεση του κυττάρου πραγματοποιήθηκε αμοιβαία μετατόπιση μεταξύ των χρωμοσωμάτων 5, στο οποίο εδράζεται η παραπάνω αλυσίδα, και 17. Κατά τη θραύση του χρωμοσώματος 5, η αλυσίδα κόπηκε στη μέση με αποτέλεσμα να τροποποιηθεί η αλληλουχία των βάσεών. Η νέα αλληλουχία, μετά την αμοιβαία μετατόπιση, είναι η εξής:

5’ – TTGAATTCAAATGTGTCGAATGCCGGTTTTAAAGCCCAGCTT – 3’

Θα επηρεαστεί το παραγόμενο προϊόν από την μετάλλαξη; Τι γνωρίζετε για την αμοιβαία μετατόπιση;

  1. Θέλουμε να κλωνοποιήσουμε το γονίδιο, πριν και μετά την αμοιβαία μετατόπιση, για τη δημιουργία γονιδιωματικής βιβλιοθήκης. Είναι εφικτό, και αν ναι, ποιά περιοριστική ενδονουκλεάση θα χρησιμοποιήσουμε;

Απαντήσεις:

ΘΕΜΑ 1ο

  1. γ,        2.  δ,          3. γ,          4.  δ,        5. γ.

ΘΕΜΑ 2ο

  1. Από σχ. βιβλ. Σελ. 36-37: «Κατά την έναρξη …η μεγάλη υπομονάδα του ριβοσώματος συνδέεται με τη μικρή».
  2. Από σχ. βιβλ. Σελ. 119-120: «Ανοσοδιαγνωστικά. Τα μονοκλωνικά αντισώματα … να είναι επιτυχείς.»
  3. Από σχ. βιβλ. Σελ. 14 – 15: «Δεδομένα από την ανάλυση … που το καθιστούν μόριο ιδανικό ως γενετικό υλικό.»
  4. Από σχ. βιβλ. Σελ. 40 – 41: «Το οπερόνιο της λακτόζης ... τη λειτουργία των τριών γονιδίων.»
  5. i.          Το 1ο κύτταρο είναι σωματικό και βρίσκεται στο στάδιο της μετάφασης της κυτταρικής διαίρεσης, κατά το

οποίο τα χρωμοσώματα αποκτούν μέγιστο βαθμό συσπείρωσης. Παρατηρούμε 44 αυτοσωμικά χρωμοσώματα σε ζεύγη, εφόσον το καθένα είναι ίδιο σε μορφή με κάποιο άλλο, επίσης το φυλετικό ζεύγος αποτελείται από ένα Χ και ένα Υ χρωμόσωμα τα οποία διαφέρουν αρκετά σε μήκος μεταξύ τους. Στον άνθρωπο η παρουσία του Υ χρωμοσώματος καθορίζει το αρσενικό άτομο, ενώ η απουσία του το θηλυκό άτομο.

Το 2ο κύτταρο είναι επίσης σωματικό, στο στάδιο της μετάφασης και ανήκει σε θηλυκό άτομο, καθώς τα χρωμοσώματα του φυλετικού ζεύγους είναι ίδια σε μήκος μεταξύ τους, άρα αποτελείται από δύο Χ.

Το 3ο κύτταρο αποτελείται από 46 ινίδια χρωματίνης σε ζεύγη, επομένως είναι σωματικό κύτταρο κατά το στάδιο της μεσόφασης και μάλιστα πριν την αντιγραφή του γενετικού υλικού. Το κάθε ινίδιο χρωματίνης είναι ίδιο με κάποιο άλλο, επομένως το κύτταρο ανήκει σε θηλυκό άτομο.

Το 4ο κύτταρο είναι σωματικό κύτταρο κατά το στάδιο της μετάφασης και ανήκει σε άτομο με μονοσωμία στο φυλετικό ζεύγος (ΧΟ), εφόσον από τα 44 χρωμοσώματα είναι το καθένα ίδιο σε μορφή με κάποιο άλλο. Το άτομο πάσχει από σύνδρομο Turner, το οποίο είναι η μοναδική μονοσωμία που έχει βρεθεί στον άνθρωπο. Τα άτομα αυτά δεν εμφανίζουν δευτερογενή χαρακτηριστικά του φύλου, παρ’ όλο που έχουν φαινότυπο θηλυκού ατόμου, και είναι στείρα.

Το 5ο κύτταρο περιέχει 23 ινίδια χρωματίνης, δηλαδή τη μισή ποσότητα γενετικού υλικού από τα προηγούμενα και σε ένα αντίγραφο καθώς είναι ανόμοια μεταξύ τους, επομένως είναι γαμέτης.

ii.    Τα ινίδια χρωματίνης δεν είναι ορατά ως μεμονωμένες δομές με το οπτικό μικροσκόπιο, στο ηλεκτρονικό όμως, ύστερα από ειδική επεξεργασία, μοιάζουν με κομπολόγια από χάντρες. Κατά τη μετάφαση της κυτταρικής διαίρεσης, ο υψηλός βαθμός συσπείρωσης καθιστά τα μεταφασικά χρωμοσώματα ευδιάκριτα και έτσι είναι εύκολο να παρατηρηθούν με το οπτικό μικροσκόπιο. Άρα, οι παρατηρήσεις για τα κύτταρα 1,2 και 4 έγιναν με οπτικό μικροσκόπιο, ενώ για τα κύτταρα 3 και 5 με ηλεκτρονικό.

ΘΕΜΑ 3ο

Γ1.       α.         Η ινσουλίνη είναι μία ορμόνη που ρυθμίζει τον μεταβολισμό των υδατανθράκων και ειδικότερα το ποσοστό της

γλυκόζης στο αίμα. Ο διαβήτης είναι μία ασθένεια που χαρακτηρίζεται από έλλειψη ή μείωση ινσουλίνης και υπολογίζεται ότι πάνω από 60.000.000 άτομα στον κόσμο πάσχουν από διαβήτη. Η ινσουλίνη χρησιμοποιείται για τη θεραπεία των διαβητικών ατόμων.

β.  Η ινσουλίνη είναι μία ορμόνη που αποτελείται από 51 αμινοξέα και παράγεται από ειδικά κύτταρα του παγκρέατος. Η ινσουλίνη αποτελείται από δύο μικρά πεπτίδια, Α και Β, που συγκρατούνται μεταξύ τους με δισουλφιδικούς δεσμούς. Το γονίδιο της ινσουλίνης παράγει ένα πρόδρομο μόριο, την προϊνσουλίνη, το οποίο μετατρέπεται τελικά σε ινσουλίνη.

γ. Μία από τις μεθόδους περιλαμβάνει την κατασκευή cDNA βιβλιοθήκης από τα κύτταρα του παγκρέατος στα οποία εκφράζεται το γονίδιο της ινσουλίνης και την επιλογή του κλώνου που περιέχει το γονίδιο. Συνοπτικά τα στάδια κλωνοποίησης και απομόνωσης του γονιδίου της ινσουλίνης είναι:

  • Απομόνωση του συνολικού mRNA, από τα κύτταρα του ανθρώπινου παγκρέατος.
  • Κατασκευή δίκλωνων μορίων DNA και ενσωμάτωση τους σε πλασμίδια.
  • Μετασχηματισμός βακτηρίων με τα ανασυνδυασμένα πλασμίδια και πολλαπλασιασμός τους σε υγρό θρεπτικό υλικό.
  • Επιλογή των βακτηρίων που περιέχουν το γονίδιο το οποίο κωδικοποιεί το πρόδρομο μόριο της ινσουλίνης.
  • Ανάπτυξη των βακτηρίων αυτών σε βιοαντιδραστήρα για παραγωγή του πρόδρομου μορίου της ινσουλίνης. Η προϊνσουλίνη συλλέγεται και με κατάλληλο ένζυμο, που αφαιρεί το ενδιάμεσο πεπτίδιο, μετατρέπεται σε ινσουλίνη.

Γ2.     α.            Παρατηρώντας το γενεαλογικό δέντρο εξάγουμε το συμπέρασμα ότι η αχονδροπλασία οφείλεται σε επικρατές

αλληλόμορφο αφού οι ασθενείς γονείς Ι1 και Ι2 αποκτούν δύο παιδιά με την ασθένεια καθώς και οι γονείς ΙΙ2 (ασθενής πατέρας) και ΙΙ3 (φυσιολογική μητέρα) αποκτούν γιο ασθενή.

Θα μπορούσατε να αναφέρετε ότι απορρίπτεται η περίπτωση της αυτοσωμικής υπολειπόμενης και φυλοσύνδετης υπολειπόμενης κληρονομικότητας, διότι από ασθενείς γονείς Ι1 και Ι2 δε μπορεί να προκύψει απόγονος φυσιολογικός (ΙΙ1).

Επίσης, απορρίπτεται η περίπτωση της φυλοσύνδετης επικρατούς κληρονομικότητας, μιας και στη δεύτερη γενιά είναι αδύνατο από ασθενή πατέρα (Ι2) και υγιή μητέρα (ΙΙ3) να προκύψει αρσενικός απόγονος με την ασθένεια (ΙΙΙ1).

Από τα παραπάνω καταλαβαίνουμε ότι ο τρόπος κληρονόμησης της αχονδροπλασίας είναι αυτοσωμικός επικρατής και συγκεκριμένα, αν συμβολίσουμε με Α το παθολογικό αλληλόμορφο και με α το φυσιολογικό αλληλόμορφο, οι γονότυποι των ατόμων που περιγράφονται στο γενεαλογικό δέντρο είναι:

Γενιά Ι: Ι1 à Αα, Ι2 à Αα

Γενιά ΙΙ: Ι1 à αα, Ι2 àΑΑ ή Αα, Ι3 à αα

Γενιά ΙΙΙ: ΙΙΙ3 à Αα

Γ2.       β.         Τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης, άρα

και της ινσουλίνης, από ένα διαγονιδιακό ζώο είναι τα παρακάτω:

  • Απομόνωση του ανθρώπινου γονιδίου που κωδικοποιεί την ισουλίνη.
  • Μικροέγχυση του γονιδίου στον πυρήνα ενός γονιμοποιημένου ωαρίου του ζώου.
  • Τοποθέτηση του γενετικά τροποποιημένου ζυγωτού στη μήτρα ενήλικου ζώου για κυοφορία.
  • Γέννηση του διαγονιδιακού ζώου.
  • Διασταυρώσεις με σκοπό να περάσει η τροποποιημένη γενετική πληροφορία στους απογόνους.
  • Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Η αχονδροπλασία θα μπορούσε να διαγνωσθεί με ασφάλεια με μοριακή διάγνωση, δηλαδή με ανάλυση της αλληλουχίας των βάσεων του DNA για το συγκεκριμένο γονίδιο που μελετάμε. Για την επίτευξη της απαραίτητη κρίνεται η συλλογή εμβρυικών κυττάρων είτε με αμνιοπαρακέντηση (12η-16η εβδομάδα) είτε με τη λήψη χοριακών λαχνών (9η-12η εβδομάδα).

ΘΕΜΑ 4ο

  1. Ελέγχοντας την παραπάνω αλυσίδα κατά φορά 5’ à 3’, παρατηρούμε ότι είναι η κωδική αλυσίδα του γονιδίου, καθώς περιέχει το κωδικόνιο ATG που αντιστοιχεί στο κωδικόνιο έναρξης AUG του mRNA, το κωδικόνιο λήξης TGA και ικανοποιείται το βήμα τριπλέτας του γενετικού κώδικα. Η κωδική αλυσίδα είναι συμπληρωματική και αντιπαράλληλη της μη κωδικής που είναι η μεταγραφόμενη. Ο προσανατολισμός της μεταγραφής είναι 5’ à 3’. Επομένως, το mRNA που θα προκύψει θα είναι:

5’- UUGAAUUCAAAUGUGUCGAAUUACAGAGUGAUUAGAAUUCGG -3’

  1. Το παραπάνω mRNA περιέχει 7 κωδικόνια από το κωδικόνιο έναρξης 5΄-AUG-3΄ μέχρι το κωδικόνιο λήξης 5΄-UGA-3΄. Κάθε κωδικόνιο κωδικοποιεί ένα αμινοξύ εκτός από το κωδικόνιο λήξης, το οποίο οδηγεί στον τερματισμό της σύνθεσης της πολυπεπτιδικής αλυσίδας. Επομένως, κωδικοποιούνται συνολικά 6 αμινοξέα.
  1. Κάθε μόριο tRNA έχει μια ειδική τριπλέτα νουκλεοτιδίων, το αντικωδικόνιο, με την οποία προσδένεται, λόγω συμπληρωματικότητας, με το αντίστοιχο κωδικόνιο του mRNA. Επιπλέον, διαθέτει μια ειδική θέση σύνδεσης με ένα συγκεκριμένο αμινοξύ, το οποίο μεταφέρει στη θέση της πρωτεϊνοσύνθεσης. Τα tRNA που θα συμμετέχουν είναι τα εξής:

3’ UAC 5’

3’ ACA 5’

3’ GCU 5’

3’ UAA 5’

3’ UGU 5’

3’ CUC 5’

Για το κωδικόνιο λήξης δεν αντιστοιχεί κάποιο tRNA αφού δεν κωδικοποιεί κανένα αμινοξύ.

  1. Παρατηρούμε ότι μετά την μετάλλαξη έχει αλλάξει η αλληλουχία των κωδικονίων του γονιδίου και επιπλέον δε μπορούμε να εντοπίσουμε κάποιο από τα κωδικόνια λήξης (TGA, TAG, TAA). Αυτό σημαίνει ότι δε θα παραχθεί καθόλου η πρωτεΐνη που κωδικοποιείται φυσιολογικά από το παραπάνω γονίδιο καθώς έχει αλλοιωθεί η περιεχόμενη γενετική πληροφορία.

Η αμοιβαία μετατόπιση είναι δομική χρωμοσωμική μετάλλαξη κατά την οποία έχουμε «ανταλλαγή» χρωμοσωμικών τμημάτων ανάμεσα σε μη ομόλογα χρωμοσώματα. Στις αμοιβαίες μετατοπίσεις δε χάνεται γενετικό υλικό και τα άτομα που τις φέρουν εμφανίζουν συνήθως φυσιολογικό φαινότυπο. Ταυτόχρονα όμως εμφανίζουν κίνδυνο απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες, επειδή κατά το ζευγάρωμα των χρωμοσωμάτων στη μειωτική διαίρεση προκύπτουν και μη φυσιολογικοί γαμέτες.

  1. Η περιοριστική ενδονουκλεάση EcoRI αναγνωρίζει την αλληλουχία 5’-GAATTC-3’

                                                                                              3’-CTTAAG-5’

στο γονίδιο και κόβει κάθε αλυσίδα μεταξύ του G  και του A (με κατεύθυνση 5’-3’) αφήνοντας μονόκλωνα άκρα από αζευγάρωτες βάσεις στα κομμένα άκρα. Βρίσκουμε την αλληλουχία αυτή δύο φορές στην παραπάνω αλυσίδα, πριν το κωδικόνιο έναρξης του γονιδίου και μετά το κωδικόνιο λήξης, επομένως μπορεί να κλωνοποιηθεί με χρήση του κατάλληλου φορέα κλωνοποίησης. Μετά την αμοιβαία μετατόπιση όμως δεν υφίσταται πλέον το γονίδιο και η αλληλουχία βρίσκεται μόνο μια φορά στην αρχή της αλυσίδας.

 

Επιμέλεια θεμάτων: Πανάγου Αναστασία – Παπαδάκης Αντώνης

 

alfavita.gr

Επισκεφθείτε το φροντιστηριακό όμιλο ΕΝΑ εδώ

Όλες οι σημαντικές ειδήσεις σήμερα

Σχολεία: Ένα self test για μαθητές-εκπαιδευτικούς από τις 17 Μαΐου

Πανελλαδικές 2021: Ανακοινώθηκε το πρόγραμμα εξετάσεων για ΓΕΛ - ΕΠΑΛ

Σε όλα τα σχολεία το ΥΠΟΧΡΕΩΤΙΚΟ μάθημα ΣΕΞΟΥΑΛΙΚΗΣ ΑΓΩΓΗΣ - ΝΕΟ ΣΕΜΙΝΑΡΙΟ ΓΙΑ ΜΟΡΙΟΟΤΗΣΗ

Το Κορυφαίο Μοριοδοτούμενο σεμινάριο στην ΕΙΔΙΚΗ ΑΓΩΓΗ του Παν.Αιγαίου ΧΩΡΙΣ ΕΞΕΤΑΣΕΙΣ!

Μόρια για Προσλήψεις - ΑΣΕΠ - Μεταπτυχιακά με ΠΙΣΤΟΠΟΙΗΣΗ ΑΓΓΛΙΚΩΝ LTE του GoLearn - ΤΗΛΕΞΕΤΑΣΗ ΜΟΝΟ σε Reading - Listening

ΠΙΣΤΟΠΟΙΗΣΗ ΥΠΟΛΟΓΙΣΤΩΝ για ΑΣΕΠ σε 10 ημέρες εξ αποστάσεως με ΔΩΡΕΑΝ ΕΠΑΝΕΞΕΤΑΣΕΙΣ ΚΑΙ 97% ΕΠΙΤΥΧΙΑ

σχετικά άρθρα

Έγκλημα στα Γλυκά Νερά: «Κατάλαβα ότι είναι νεκρή όταν με έλυσαν οι αστυνομικοί»
Ο σύζυγος της 20χρονης επισκέφθηκε το σπίτι τους - Μίλησε για το πότε συνειδητοποίησε πως η σύζυγός του ήταν νεκρή
Έγκλημα στα Γλυκά Νερά: «Κατάλαβα ότι είναι νεκρή όταν με έλυσαν οι αστυνομικοί»
kerameos
Κεραμέως: 5 άξονες για το σχολείο πολλαπλών γνώσεων και των δεξιοτήτων
Ήπιες ψηφιακές δεξιότητες, αξιολόγηση και σύνδεση με την αγορά εργασίας. Αυτοί είναι ορισμένοι από τους βασικούς άξονες της μεταρρυθμιστικής...
Κεραμέως: 5 άξονες για το σχολείο πολλαπλών γνώσεων και των δεξιοτήτων
ΙΕΚ: Προτάσεις ΣΒΕ για νέες ειδικότητες που ενδιαφέρουν τη βιομηχανία
Συνάντηση της Διοίκησης του Συνδέσμου Βιομηχανιών Ελλάδας (ΣΒΕ) με τον Γενικό Γραμματέα του Υπουργείου Παιδείας Δρα Γ. Βούτσινο
ΙΕΚ: Προτάσεις ΣΒΕ για νέες ειδικότητες που ενδιαφέρουν τη βιομηχανία
ανοικτά σχολεία αίθουσα
ΣΥΝΕΚ Λάρισας: Κινητοποιήσεις για τα πειραματικά σχολεία
Σε κινητοποίηση για τη μετατροπή σχολείων σε Πειραματικά καθώς και για τον εξοβελισμό της Καλλιτεχνικής Παιδείας στο Λύκειο προχώρησαν οι...
ΣΥΝΕΚ Λάρισας: Κινητοποιήσεις για τα πειραματικά σχολεία